igrep
a fast CUDA implementation of agrep algorithm for approximate nucleotide sequence matching
Jobs
New job
The input to igrep is twofold:
- A genome to search. Totally 26 assembled genomes are collected from ftp://ftp.ncbi.nih.gov/genomes. Their sizes vary from 3.50Gnt to 0.19Gnt, accounting for 44Gnt in total.
- A set of queries. A query consists of a pattern of alphabet A, C, G, T, N, followed by an edit distance. N is a wildcard and can match either A, C, G, or T in the genome. The pattern length must be between 1 and 64. The edit distance must be between 0 and 9, and must not exceed the pattern length. Substitution, insertion and deletion have a uniform cost of one edit distance. For each job, up to 10,000 queries will be processed.
The output from igrep is twofold:
log.csv: summary of queries and results.- pos.csv: ending positions of matches. For each query, up to 1,000 matches will be returned.
Genomes
Tutorials
How to use the REST API to programmatically submit multiple jobs in batch and query for job status
Submit a new job via HTTP POST
curl http://istar.cse.cuhk.edu.hk/igrep/jobs -d 'email=Jacky@cuhk.edu.hk&taxid=9606
&queries=CTGCATGGTGGGGAAAAGGCATAGCCTGGG3
AAAAGTGTTATGGGTTGTTTAATCAACCACTGAACTGCGGGGGTGACTAGTTATAACTTA6'
Obtain existing jobs via HTTP GET
curl http://istar.cse.cuhk.edu.hk/igrep/jobs/
Citation
Hongjian Li, Bing Ni, Man-Hon Wong, and Kwong-Sak Leung. A Fast CUDA Implementation of Agrep Algorithm for Approximate Nucleotide Sequence Matching. In Proceedings of the 9th IEEE Symposium on Application Specific Processors (SASP), pp.74-77, San Diego, United States, 5-6 June 2011. DOI: 10.1109/SASP.2011.5941082