igrep
a fast CUDA implementation of agrep algorithm for approximate nucleotide sequence matching
a fast CUDA implementation of agrep algorithm for approximate nucleotide sequence matching
The input to igrep is twofold:
The output from igrep is twofold:
Submit a new job via HTTP POST
curl http://istar.cse.cuhk.edu.hk/igrep/jobs -d 'email=Jacky@cuhk.edu.hk&taxid=9606 &queries=CTGCATGGTGGGGAAAAGGCATAGCCTGGG3 AAAAGTGTTATGGGTTGTTTAATCAACCACTGAACTGCGGGGGTGACTAGTTATAACTTA6'
Obtain existing jobs via HTTP GET
curl http://istar.cse.cuhk.edu.hk/igrep/jobs/
Hongjian Li, Bing Ni, Man-Hon Wong, and Kwong-Sak Leung. A Fast CUDA Implementation of Agrep Algorithm for Approximate Nucleotide Sequence Matching. In Proceedings of the 9th IEEE Symposium on Application Specific Processors (SASP), pp.74-77, San Diego, United States, 5-6 June 2011. DOI: 10.1109/SASP.2011.5941082